26
May
09

DNA is not code

Edit: For my argument that DNA is not Code, go here.

I had a comment on my “Information in DNA” post which I shall share.

You have some severe issues with your reasoning…

Please point them out specifically.

It is beyond any reasoning,

Then it isn’t a problem with my reasoning if it is beyond reasoning; which I have yet to find something which is.

and any biologist knows, that DNA DOES hold information.

Am I not a biologist now? You are confusing the metaphor for reality; it is frequently done.

Ofcourse, you can easily put a genetic strand together out of random bases, but what would that translate to?

You are, once again, making the argument that all useful parts of a gene are translated into something. What you are forgetting is that intermediate step in which the DNA is first transcribed; this, in some cases, is the final step (ribozymes). So, instead of having this “coding” for something, it IS the molecule.

The fact is a single mutation to a gene can lead to the death of the organism.

You forget way too many commas and spaces. I digress to the topic at hand; these must be very, very specific mutations. Considering the rate of mutation (10-4 to 10-6 mutations per base pair per generation) of eukaryotes, the chances of these mutations occurring at the specific location is very rare. Additionally, all organisms die, the real thing you must look at is if it prevents reproduction.

Therefore, the ordering is specified!

By whom?

Meaning it has rules and guidelines that it follows – and wait for it… INFORMATION.

I apologize once again for my ignorance, did you say you were a computer engineer? It doesn’t follow anything, in order for this DNA to be passed on, the organism must survive; the mutations DO happen, though rare, and this rarity can be explained by selective pressures for lower mutation rates in certain areas of the genome (due to efficacy of proof-reading enzymes with certain sequences). If, as you say, this DNA follows rules or guidelines, please explain what these rules are so as I can provide specific examples of each one being flagrantly violated like an alter boy.

I am absolutely dumbfounded by your belief in what you have written.

You seemed this way (and angry, too) prior to reading my writing; I assume you are the one that came here after a search for “quaternary DNA.” Once again, learn biology, quit thinking of it as code, and it may make sense.

Considering it is a well known fact that a human genome has all the information it requires to create a human from embryonic stage to full grown adult.

No, it contains proteins and enzymes with regulatory mechanisms sensitive to certain factors produced by both itself and those from the mother. Additionally, thinking of DNA as a computer program will only make the following more difficult to understand. (I WAS a computer technician prior to studying biology; I struggled with this too, trust me for a moment) Some genes are sensitive to certain signals (SHH, BMPs, and others, for example) in time dependent, concentration dependent, or independent of these in various combinations.

Re-arrange those very same DNA bases and you have completely lost your human. Just as, if you re-arrange all the letters in this sentence, you would have lost this sentence (and its meaning).

You are equating a means of communcation (information) with a molecule which does not communicate ANYTHING, was never constructed so as to communcate anything, and has never communicated anything. It is an analogy; to conclude, then, that the analogy means DNA is information just like your sentence is to assume the following premises:
1) Someone constructed this DNA in the exact sequence you find it today
2) Any change in DNA completely changes what it will do
3) A human is only the DNA which he or she carries
I disagree with all three of these.

Just as 101010111010 represents binary. ACTCTTGCGGCGGGCATGACACGT represents quartanary (dna).

Your very first part of your “code” would cause the translation (into protein) of the associated RNA transcript to terminate, so unless this is a ribozyme, your “code” fails. If it is is transcribed into a ribozyme, then it isn’t a code since the complementary sequence is the functional unit, thus the “code” does not “translate” into anything. I’ll leave it up to you to figure out why.

Both can hold information if they are sequenced in a meaningful way.

And DNA is not sequenced in a meaningful way. Its sequence is a result of natural selection, genetic drift, and other natural processes.

Ofcourse randomly they are gibberish. But something can translate them into existance

Actually, they must first be transcribed, or did you not learn that in high school, since I doubt you’ve had any courses in genetics.

– wether life, or a computer program, then they hold valuable code and meaning. Grow up.

What a lovely little snipe at the end of this; no, they hold no code, nor meaning. You should understand the difference between metaphor and reality.


4 Responses to “DNA is not code”


  1. May 27, 2009 at 6:45 am

    I think the confusion is understandable, since we learn (and are taught)through metaphor and analogy. We need tools to get our minds around concepts. We use catagories to order our thinking, but often confuse the boxes for the objects we put into them.

    This is especially so for things about which we know and have learned little. You think on the matter of DNA with more clarity due to a more complete background. Most of us will have little more than the metaphors and analogies by which they were introduced to the subject.

    To add to the confusion many people only seek enough knowledge to protect their world view. If the analogy of DNA as coded information aids in that cause, such an analogy will be embraced and held to be true.

    Your point is important, and clearly presented. Babies and bath water are not one and the same.

    Mike

  2. 3 Pliny-the-in-Between
    May 27, 2009 at 1:21 pm

    Sounds like this individual is a student of Dembski, whose chief claim to fame would be to make up a phrase (specified complexity) then repeat it over and over as canon.

  3. 4 jaredcormier
    May 27, 2009 at 3:49 pm

    It is so unfortunate such individuals confuse the metaphor of “DNA ‘encoding’ proteins” for what is actually happening; DNA is a acted upon by various proteins and ribozymes which, based upon their varied interactions, produce products which are used in the cell. I understand using the metaphor as it reduces the entire chain of events to a single sentence; I do not understand individuals with very minimal knowledge of these processes making claims about them.


Leave a Reply




Join the best atheist themed blogroll!

Older stuff

wordpress stats